Top » Catalog » R1b » A1036

$18.00

A1036
[A1036]

A1036
HG19 Position: ChrY:6997155..6997155
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > A1002
Forward Primer: A1036_F TCCTGGGTACGATGTCACAC
Reverse Primer: A1036_R ACTCGTTGCAAGGTTCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10116
1 x A10144
1 x A10319
1 x A10308
1 x A10328
1 x A10292
1 x A10139
1 x A10131
1 x A1010
1 x A10155
1 x A10113
1 x A10243
1 x A10283
1 x A10287
1 x A10236
1 x A10234
1 x A10109
1 x A10325
1 x A1011
1 x A10023
1 x A10282
1 x A10132
1 x A101
1 x A10125
1 x A10145
1 x A10320
1 x A10314
1 x A10244
1 x A10114
1 x A10022
1 x A10295
1 x A1019
1 x A10291
1 x A10027
1 x A10165
1 x A1
1 x A10118
1 x A10290
1 x A10235
1 x A10330
1 x A10289
1 x A10327
1 x A10119
1 x A10245
1 x A10286
1 x A10142
1 x A1000
1 x A103
1 x A10138
1 x A10219
1 x A10154
1 x A10315
1 x A10322
1 x A1024
1 x A10136
1 x A10141
1 x A10285
1 x A10284
1 x A10218
1 x A10237
1 x A1028
1 x A10137
1 x A10152
1 x A10140
1 x A1017
1 x A10129
1 x A10127
1 x A10134
1 x A1020
$1,242.00
Haplogroup Info
Other products
Currencies