Top » Catalog » R1b » A1036

$16.00

A1036
[A1036]

A1036
HG19 Position: ChrY:6865196..6865196
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > A1002
Forward Primer: A1036_F TCCTGGGTACGATGTCACAC
Reverse Primer: A1036_R ACTCGTTGCAAGGTTCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10288
1 x A10117
1 x A10322
1 x A10327
1 x A1024
1 x A10136
1 x A10236
1 x A10135
1 x A10329
1 x A10145
1 x A1030
1 x A10114
1 x A10282
1 x A10239
1 x A10311
1 x A10115
1 x A10165
1 x A10139
1 x A10293
1 x A10121
1 x A10299
1 x A10310
1 x A10113
1 x A10237
1 x A10137
1 x A1028
1 x A10123
1 x A103
1 x A10292
1 x A10128
1 x A10308
1 x A10244
1 x A10109
1 x A10312
1 x A10326
1 x A10124
1 x A10240
1 x A10323
1 x A10151
1 x A10141
1 x A10130
1 x A10305
1 x A10238
1 x A10107
1 x A10286
$720.00
Haplogroup Info
Other products
Currencies