Top » Catalog » R1b » A1036

$18.00

A1036
[A1036]

A1036
HG19 Position: ChrY:6865196..6865196
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > A1002
Forward Primer: A1036_F TCCTGGGTACGATGTCACAC
Reverse Primer: A1036_R ACTCGTTGCAAGGTTCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10299
1 x A10145
1 x A10311
1 x A10128
1 x A10296
1 x A10159
1 x A10127
1 x A1034
1 x A10135
1 x A10235
1 x A10285
1 x A10115
1 x A10294
1 x A10114
1 x A10234
1 x A10237
1 x A10137
1 x A1028
1 x A10241
1 x A10022
1 x A1001
1 x A10129
1 x A10130
1 x A100
1 x A10122
1 x A10150
1 x A10308
1 x A10148
1 x A10328
1 x A10309
1 x A1011
1 x A10238
1 x A10323
1 x A10316
1 x A10327
1 x A10290
1 x A10124
1 x A1012
1 x A10325
1 x A1031
1 x A10245
1 x A10119
1 x A10027
$774.00
Haplogroup Info
Other products
Currencies