Top » Catalog » R1b » A1036

$18.00

A1036
[A1036]

A1036
hg38 Position: ChrY:6997155..6997155
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > A1002
Forward Primer: A1036_F TCCTGGGTACGATGTCACAC
Reverse Primer: A1036_R ACTCGTTGCAAGGTTCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10154
1 x A10322
1 x A10235
1 x A10135
1 x A10287
1 x A10286
1 x A10218
1 x A10118
1 x A10137
1 x A10294
1 x A10238
1 x A10236
1 x A10136
1 x A1024
1 x A10130
1 x A10308
1 x A10121
1 x A10291
1 x A10315
1 x A10124
1 x A10244
1 x A10153
1 x A1012
1 x A10326
$432.00
Haplogroup Info
Other products
Currencies