Top » Catalog » R1b » A150

$18.00

A150
[A150]

A150
hg38 Position: ChrY:8619461..8619461
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b2
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A150_F AACATTGCTGTGCAAACTGG
Reverse Primer: A150_R TTATCGGGCAAATTCAGACAG
Reviews

Customers who bought this product also purchased
S1115
S1115
BY2880
BY2880
A923
A923
A1511
A1511
A664
A664
Z17981
Z17981
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies