Top » Catalog » R1b » A151

$18.00

A151
[A151]

A151
hg38 Position: ChrY:14930656..14930656
Ancestral: C
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A151_F CATTTCTCTCAAAAGTAGTAATTCCCA
Reverse Primer: A151_R TGTGCTAATGTTCTTTAGCACAGC
Reviews

Customers who bought this product also purchased
A9005
A9005
BY39363
BY39363
BY16028
BY16028
BY39361
BY39361
BY3863
BY3863
A1133
A1133
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies