Top » Catalog » R1b » A152

$18.00

A152
[A152]

A152
hg38 Position: ChrY:20038668..20038668
Ancestral: A
Derived: C
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A152_F AACATTAATGCAAAAATCCTTGATG
Reverse Primer: A152_R CCATTCAGTATGATATTAGCTATGGAC
Reviews

Customers who bought this product also purchased
A151
A151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies