Top » Catalog » R1b » A152

$18.00

A152
[A152]

A152
hg38 Position: ChrY:20038668..20038668
Ancestral: A
Derived: C
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A152_F AACATTAATGCAAAAATCCTTGATG
Reverse Primer: A152_R CCATTCAGTATGATATTAGCTATGGAC
Reviews

Customers who bought this product also purchased
A151
A151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies