Top » Catalog » R1b » A2123

$18.00

A2123
[A2123]

A2123
hg38 Position: ChrY:7245513..7245513
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2123_F TCTTTAGTATGACATGCATTTTTCC
Reverse Primer: A2123_R GAATCTCAGTGTCGCCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2210
1 x A974
1 x A555
1 x A1190
1 x A136
1 x A176
1 x A664
1 x A99
1 x A349
1 x A1000
1 x A1334
1 x A354
1 x A718
1 x A1075
$252.00
Haplogroup Info
Other products
Currencies