Top » Catalog » R1b » A2124

$18.00

A2124
[A2124]

A2124
hg38 Position: ChrY:7376715..7376715
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2124_F TGCTTAAGGCCAGGAGTTTG
Reverse Primer: A2124_R TTTCTCGCTTTTCCCAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A192
1 x A895
1 x A1320
1 x A1101
$72.00
Haplogroup Info
Other products
Currencies