Top » Catalog » R1b » A2131

$18.00

A2131
[A2131]

A2131
hg38 Position: ChrY:15740735..15740735
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2131_F TAGAATTTATATTCAAAAAACTGTACAGTCTTG
Reverse Primer: A2131_R CTGTATGAATGTGTAAACACACACATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A935
1 x A37
1 x A1315
$54.00
Haplogroup Info
Other products
Currencies