Top » Catalog » R1b » A2131

$18.00

A2131
[A2131]

A2131
hg38 Position: ChrY:15740735..15740735
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2131_F TAGAATTTATATTCAAAAAACTGTACAGTCTTG
Reverse Primer: A2131_R CTGTATGAATGTGTAAACACACACATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A640
1 x A1230
1 x A2159
1 x A1499
1 x A238
1 x A1753
1 x A1490
1 x A534
1 x A1064
1 x A494
1 x A588
1 x A772
1 x A739
1 x A1746
1 x A387
1 x A647
1 x A299
1 x A1340
1 x A796
1 x A2199
1 x A736
1 x A1297
1 x A658
1 x A638
1 x A1082
1 x A6
1 x A712
1 x A623
$504.00
Haplogroup Info
Other products
Currencies