Top » Catalog » R1b » A2133

$18.00

A2133
[A2133]

A2133
hg38 Position: ChrY:16737726..16737726
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2133_F CAAAGTTTGAATGCTGTCCTG
Reverse Primer: A2133_R TGCACATGAGCAGATAATATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
$36.00
Haplogroup Info
Other products
Currencies