Top » Catalog » R1b » A2134

$18.00

A2134
[A2134]

A2134
hg38 Position: ChrY:17338769..17338769
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2134_F TGAGTCATCTGGTTTTTCAAGC
Reverse Primer: A2134_R ACAGGAGAAATGGCCATGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1059
1 x A230
1 x A2234
1 x A431
1 x A521
1 x A741
1 x A854
1 x A150
1 x A722
1 x A355
$180.00
Haplogroup Info
Other products
Currencies