Top » Catalog » R1b » A2135

$18.00

A2135
[A2135]

A2135
hg38 Position: ChrY:18900576..18900576
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2135_F ACTTCTGCCACCAATTCACC
Reverse Primer: A2135_R ATTGCAATTAGTGCCCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2231
1 x A797
1 x A350
1 x A1289
1 x A210
$90.00
Haplogroup Info
Other products
Currencies