Top » Catalog » R1b » A153

$18.00

A153
[A153]

A153
hg38 Position: ChrY:8931814..8931814
Ancestral: G
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a2a1
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A153_F CCCTCCACATCCAGATATGTG
Reverse Primer: A153_R GCAGAACGTGCATGTTTGC
Reviews

Customers who bought this product also purchased
A1336
A1336
A1337
A1337
A541
A541
S1115
S1115
A761
A761
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies