Top » Catalog » R1b » A153

$18.00

A153
[A153]

A153
hg38 Position: ChrY:8931814..8931814
Ancestral: G
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a2a1
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A153_F CCCTCCACATCCAGATATGTG
Reverse Primer: A153_R GCAGAACGTGCATGTTTGC
Reviews

Customers who bought this product also purchased
A541
A541
S1115
S1115
A1336
A1336
A1337
A1337
A761
A761
A195
A195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies