Top » Catalog » R1b » A2139

$18.00

A2139
[A2139]

A2139
hg38 Position: ChrY:19674157..19674157
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2139_F GATCCCACAGGAAAGGAAGC
Reverse Primer: A2139_R GGACCACTGCTTTAGGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
1 x A1302
1 x A450
1 x A715
$198.00
Haplogroup Info
Other products
Currencies