Top » Catalog » R1b » A2142

$18.00

A2142
[A2142]

A2142
hg38 Position: ChrY:20494299..20494299
Ancestral: C
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2142_F GACCCAATGGCTTTGCAG
Reverse Primer: A2142_R ATGGCATCAATTGAAATGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1142
1 x A798
1 x A955
1 x A818
1 x A746
$90.00
Haplogroup Info
Other products
Currencies