Top » Catalog » R1b » A2143

$18.00

A2143
[A2143]

A2143
hg38 Position: ChrY:21444178..21444178
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2143_F CACACAGTGGAGAGAACCAGC
Reverse Primer: A2143_R CCACAGTGGCACTGTGGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A722
1 x A197
1 x A103
1 x A898
$72.00
Haplogroup Info
Other products
Currencies