Top » Catalog » R1b » A2122

$18.00

A2122
[A2122]

A2122
hg38 Position: ChrY:6911627..6911627
Ancestral: C
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2122_F AGGGGAGTCCCTTTCATCC
Reverse Primer: A2122_R CAACGACCCACAGTTGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A634
1 x A2080
1 x A889
1 x A424
$72.00
Haplogroup Info
Other products
Currencies