Top » Catalog » R1b » A2125

$18.00

A2125
[A2125]

A2125
hg38 Position: ChrY:7803397..7803397
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2125_F AATACAGTTCCAAACTCAACAATAACTG
Reverse Primer: A2125_R AAGGGCATGACTCCCTTACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies