Top » Catalog » R1b » A154

$18.00

A154
[A154]

A154
hg38 Position: ChrY:14990972..14990972
Ancestral: T
Derived: C
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a2a
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A154_F CCTGTCTCTGATAGGACCAAAACTACT
Reverse Primer: A154_R AAGGCATTCACTTGCGGTAG
Reviews

Customers who bought this product also purchased
S1115
S1115
A1336
A1336
A1337
A1337
A541
A541
A2220
A2220
A761
A761
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies