Top » Catalog » R1b » A2127

$18.00

A2127
[A2127]

A2127
hg38 Position: ChrY:8581108..8581108
Ancestral: C
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l1a1 (not listed)
Comments: FGC5496 S1088_A194/A700_CTS2457
Forward Primer: A2127_F GGCAGGCTGAAAACTCTGAC
Reverse Primer: A2127_R AGCAACCCCAGGTAACACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A989
$18.00
Haplogroup Info
Other products
Currencies