Top » Catalog » R1b » A2145

$18.00

A2145
[A2145]

A2145
hg38 Position: ChrY:14327654..14327654
Ancestral: A
Derived: G
Reference: Richard Hulan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A2145_F CACAAAGATACCTCTCTAAGCAAGG
Reverse Primer: A2145_R AAAACTATGCAAAATGAAACATAAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
1 x A165
1 x A967
1 x A517
1 x A1096
1 x A976
1 x A360
1 x A495
1 x A338
1 x A725
1 x A977
1 x A596
1 x A314
1 x A40
1 x A174
1 x A471
1 x A2148
$324.00
Haplogroup Info
Other products
Currencies