Top » Catalog » R1b » A2146

$18.00

A2146
[A2146]

A2146
hg38 Position: ChrY:21270624..21270624
Ancestral: C
Derived: T
Reference: Richard Hulan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A2146_F AGCCAGCATCATATTGACTGAG
Reverse Primer: A2146_R CATTGTAGTCATCTTTCATTGCTTTAG
Reviews

Customers who bought this product also purchased
M343
M343
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y62612
Y62612
BY27831
BY27831
Y30754
Y30754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A159
1 x A2071
1 x A803
$54.00
Haplogroup Info
Other products
Currencies