Top » Catalog » R1b » A2146

$18.00

A2146
[A2146]

A2146
hg38 Position: ChrY:21270624..21270624
Ancestral: C
Derived: T
Reference: Richard Hulan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A2146_F AGCCAGCATCATATTGACTGAG
Reverse Primer: A2146_R CATTGTAGTCATCTTTCATTGCTTTAG
Reviews

Customers who bought this product also purchased
L238
L238
BY96801
BY96801
BY27833
BY27833
Y138237
Y138237
M343
M343
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
1 x A165
1 x A967
1 x A517
1 x A1096
1 x A976
1 x A360
1 x A495
1 x A338
1 x A725
1 x A977
1 x A596
1 x A314
1 x A40
1 x A174
1 x A471
1 x A2148
1 x A1092
1 x A1777
$360.00
Haplogroup Info
Other products
Currencies