Top » Catalog » R1b » A2147

$18.00

A2147
[A2147]

A2147
hg38 Position: ChrY:6955483..6955483
Ancestral: A
Derived: G
Reference: Charles Moore (2015)
ISOGG Haplogroup: R1b1a1a2a1a1f
Comments: At the top of U106
Forward Primer: A2147_F AGGACTCTTTATTCTCCCTCTTGG
Reverse Primer: A2147_R CCTGCCATCTTTATCTATTTTTCAG
Reviews

Customers who bought this product also purchased
M78
M78
P312
P312
L1029
L1029
A2150
A2150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
$18.00
Haplogroup Info
Other products
Currencies