Top » Catalog » R1b » A155

$18.00

A155
[A155]

A155
hg38 Position: ChrY:7850210..7850210
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A155_F CACGCTGGTCTCTAACTCCC
Reverse Primer: A155_R TCTGTCCATGGAGTTCTTATGTTG
Reviews

Customers who bought this product also purchased
A156
A156
A1333
A1333
A541
A541
A761
A761
A90
A90
Z16254
Z16254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies