Top » Catalog » R1b » A155

$18.00

A155
[A155]

A155
hg38 Position: ChrY:7850210..7850210
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A155_F CACGCTGGTCTCTAACTCCC
Reverse Primer: A155_R TCTGTCCATGGAGTTCTTATGTTG
Reviews

Customers who bought this product also purchased
A156
A156
A90
A90
A1333
A1333
A541
A541
A761
A761
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies