Top » Catalog » R1b » A2149

$18.00

A2149
[A2149]

A2149
hg38 Position: ChrY:10011783..10011783
Ancestral: C
Derived: G
Reference: Charles Moore (2015)
ISOGG Haplogroup: R1b1a1a2a1a1f
Comments: At the top of U106
Forward Primer: A2149_F CTCCATCTAGGATTGCAAATGTG
Reverse Primer: A2149_R GTGGCAGTGGTCTGAGATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies