Top » Catalog » R1b » A2151

$18.00

A2151
[A2151]

A2151
hg38 Position: ChrY:16798332..16798332
Ancestral: T
Derived: C
Reference: Charles Moore (2015)
ISOGG Haplogroup: R1b1a1a2a1a1f
Comments: At the top of U106
Forward Primer: A2151_F TGTCATTTGTTCTACCCACAGG
Reverse Primer: A2151_R TTTCTGGGCTACCAGTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A347
$18.00
Haplogroup Info
Other products
Currencies