Top » Catalog » R1b » A2154

$18.00

A2154
[A2154]

A2154
hg38 Position: ChrY:6911894..6911894
Ancestral: G
Derived: C
Reference: Charles Acree (2015)
ISOGG Haplogroup: R1b1a2a1a1c (not listed)
Comments: .
Forward Primer: A2154_F TGCTTCCCAGTGGTACCTTC
Reverse Primer: A2154_R GTGCCAGCAGAGGAAAACAC
Reviews

Customers who bought this product also purchased
A2156
A2156
A2155
A2155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
1 x A164
1 x A1308
1 x A985
1 x A759
1 x A350
1 x A1742
1 x A251
1 x A911
1 x A642
1 x A1539
1 x A1011
$234.00
Haplogroup Info
Other products
Currencies