Top » Catalog » R1b » A2157

$18.00

A2157
[A2157]

A2157
hg38 Position: ChrY:20022748..20022748
Ancestral: T
Derived: C
Reference: Charles Acree (2015)
ISOGG Haplogroup: R1b1a2a1a1c (not listed)
Comments: .
Forward Primer: A2157_F CGTGCTTGGCCTAAGTATAATG
Reverse Primer: A2157_R AGGAGCTGTTTCTGGATAACG
Reviews

Customers who bought this product also purchased
BY1823
BY1823
A12600
A12600
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
1 x A1126
1 x A2231
1 x A25
1 x A922
1 x A2202
1 x A766
1 x A1706
1 x A433
1 x A1001
1 x A1487
1 x A989
1 x A631
1 x A2235
$414.00
Haplogroup Info
Other products
Currencies