Top » Catalog » R1b » A156

$18.00

A156
[A156]

A156
hg38 Position: ChrY:13350043..13350043
Ancestral: T
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b1a
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A156_F TGACTTCTCTTGTGAACATATGCAC
Reverse Primer: A156_R TTCAGAACACTATAACAAAATACTATGGACTAG
Reviews

Customers who bought this product also purchased
A158
A158
A157
A157
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Z16254
Z16254
A88
A88
A195
A195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies