Top » Catalog » R1b » A156

$18.00

A156
[A156]

A156
hg38 Position: ChrY:13350043..13350043
Ancestral: T
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b1a
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A156_F TGACTTCTCTTGTGAACATATGCAC
Reverse Primer: A156_R TTCAGAACACTATAACAAAATACTATGGACTAG
Reviews

Customers who bought this product also purchased
A158
A158
A157
A157
Z16254
Z16254
A88
A88
A195
A195
A155
A155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies