Top » Catalog » R1b » A2158

$18.00

A2158
[A2158]

A2158
hg38 Position: ChrY:14118731..14118731
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of Z251 > Z18098
Forward Primer: A2158_F AGCTGTCCATGCAGACCAG
Reverse Primer: A2158_R CTCTTTTGCATAAAGGGTTCTCC
Reviews

Customers who bought this product also purchased
L21
L21
A8
A8
Z18098
Z18098
L1335
L1335
FGC13899
FGC13899
Z18092
Z18092
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1058
1 x A1069
$36.00
Haplogroup Info
Other products
Currencies