Top » Catalog » R1b » A2158

$18.00

A2158
[A2158]

A2158
hg38 Position: ChrY:14118731..14118731
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of Z251 > Z18098
Forward Primer: A2158_F AGCTGTCCATGCAGACCAG
Reverse Primer: A2158_R CTCTTTTGCATAAAGGGTTCTCC
Reviews

Customers who bought this product also purchased
L21
L21
A8
A8
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC43000
FGC43000
DF41
DF41
S11556
S11556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A775
$18.00
Haplogroup Info
Other products
Currencies