Top » Catalog » R1b » A158

$18.00

A158
[A158]

A158
hg38 Position: ChrY:16848558..16848558
Ancestral: C
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b1a
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A158_F AATACAATGCAATAAAATCAAGCG
Reverse Primer: A158_R ATAAAAATAAACAGAATATCAATTATAAATTTCTTG
Reviews

Customers who bought this product also purchased
A157
A157
A156
A156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies