Top » Catalog » R1b » A158

$18.00

A158
[A158]

A158
hg38 Position: ChrY:16848558..16848558
Ancestral: C
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1b1a
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A158_F AATACAATGCAATAAAATCAAGCG
Reverse Primer: A158_R ATAAAAATAAACAGAATATCAATTATAAATTTCTTG
Reviews

Customers who bought this product also purchased
A156
A156
A157
A157
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
1 x A1269
1 x A1234
1 x A2141
$396.00
Haplogroup Info
Other products
Currencies