Top » Catalog » R1b » A159

$18.00

A159
[A159]

A159
hg38 Position: ChrY:19154116..19154116
Ancestral: C
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b3
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A159_F CTTTGTTCCCTCCCTTCCTC
Reverse Primer: A159_R ACAACCATAAAAGGCCGATG
Reviews

Customers who bought this product also purchased
BY39361
BY39361
BY39363
BY39363
BY16028
BY16028
BY3863
BY3863
FT43021
FT43021
BY39364
BY39364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies