Top » Catalog » R1b » A159

$18.00

A159
[A159]

A159
hg38 Position: ChrY:19154116..19154116
Ancestral: C
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b3
Comments: Found in R1b-CTS4466 individuals
Forward Primer: A159_F CTTTGTTCCCTCCCTTCCTC
Reverse Primer: A159_R ACAACCATAAAAGGCCGATG
Reviews

Customers who bought this product also purchased
A9005
A9005
A541
A541
A6508
A6508
S1115
S1115
BY2880
BY2880
FGC29290
FGC29290
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies