Top » Catalog » R1b » A96

$18.00

A96
[A96]

A96
hg38 Position: ChrY:6765447..6765447
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4a1b
Comments: below Z6 and above M157.2
Forward Primer: A96_F GCTCATTGATTCATCTCCACAAC
Reverse Primer: A96_R TCACACAAAACCAGCACATAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies