Top » Catalog » R1b » A1202

$18.00

A1202
[A1202]

A1202
hg38 Position: ChrY:20397400..20397400
Ancestral: G
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream CTS3937
Forward Primer: A1202_F GAAGCCTTTAAGTGTTGCTCAAG
Reverse Primer: A1202_R TACATTGTTCAGGCCAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A523
$18.00
Haplogroup Info
Other products
Currencies