Top » Catalog » R1b » A2182

$18.00

A2182
[A2182]

A2182
hg38 Position: ChrY:7335882..7335882
Ancestral: T
Derived: C
Reference: David Willson (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1 (not listed)
Comments: Below FGC12948 and above FGC12950 within R-M222
Forward Primer: A2182v2_F ACTAAATACTTTTATATGCTCATAAATTGTGA
Reverse Primer: A2182v2_R ATTATAGCAAAATTAAACAGGGCTG
Reviews

Customers who bought this product also purchased
FGC12947
FGC12947
FGC12949
FGC12949
FGC12951
FGC12951
A2183
A2183
FGC12946
FGC12946
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1773
1 x A1074
$36.00
Haplogroup Info
Other products
Currencies