Top » Catalog » R1b » A2193

$18.00

A2193
[A2193]

A2193
hg38 Position: ChrY:17085507..17085507
Ancestral: T
Derived: C
Reference: Larry Walker (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream FGC5581
Forward Primer: A2193_F CTTTCTGGCCCTCCAATATG
Reverse Primer: A2193_R GTTGGCCTACTGTGCAGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A390
1 x A569
1 x A2217
1 x A610
1 x A1743
1 x A895
1 x A61
1 x A532
1 x A1256
$162.00
Haplogroup Info
Other products
Currencies