Top » Catalog » R1b » A2194

$18.00

A2194
[A2194]

A2194
hg38 Position: ChrY:7443188..7443188
Ancestral: C
Derived: T
Reference: Larry Walker (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5a1a~
Comments: Downstream FGC5581
Forward Primer: A2194_F ACCAGCCTGGCCAACAAG
Reverse Primer: A2194_R GAATTCCTTCCCAGAATCATATTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies