Top » Catalog » R1b » A2195

$18.00

A2195
[A2195]

A2195
hg38 Position: ChrY:16273516..16273516
Ancestral: T
Derived: C
Reference: Larry Walker (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream FGC5581
Forward Primer: A2195_F GTTCATGTGTTCATCATTATAGTTATAAGC
Reverse Primer: A2195_R CATTGGCTGGCTTTGAGTATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies