Top » Catalog » R1b » A2199

$18.00

A2199
[A2199]

A2199
hg38 Position: ChrY:12540764..12540764
Ancestral: G
Derived: T
Reference: Larry Walker (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream FGC5581
Forward Primer: A2199_F CTCAGCCTCTTAACGCACTG
Reverse Primer: A2199_R GTCAAATCACTGGGGCTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies