Top » Catalog » R1b » A2200

$18.00

A2200
[A2200]

A2200
hg38 Position: ChrY:20026106..20026106
Ancestral: A
Derived: G
Reference: Larry Walker (2015)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream FGC5581
Forward Primer: A2200_F CTGCAGGCTGATTTTTCAGG
Reverse Primer: A2200_R AAATTTTCAGACCCCCATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A514
1 x A1185
1 x A30
1 x A1333
1 x A98
1 x A138
1 x A1175
1 x A1783
1 x A991
1 x A1492
1 x A2152
1 x A474
1 x A804
1 x A388
1 x A2222
1 x A81
1 x A1710
1 x A58
1 x A1
1 x A1149
1 x A211
1 x A1282
$396.00
Haplogroup Info
Other products
Currencies