Top » Catalog » R1b » A1539

$18.00

A1539
[A1539]

A1539
hg38 Position: ChrY:13219190..13219190
Ancestral: T
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1539_F TTATGCCACTGCACTTCTGC
Reverse Primer: A1539_R CCTTGGGATCTCAATGTTGG
Reviews

Customers who bought this product also purchased
R1b-Z16330 downstream panel
R1b-Z16330 downstream panel
Z17619
Z17619
A1544
A1544
A1543
A1543
A1541
A1541
A1540
A1540
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
1 x A2155
$72.00
Haplogroup Info
Other products
Currencies